View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10787_low_23 (Length: 239)
Name: NF10787_low_23
Description: NF10787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10787_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 79 - 225
Target Start/End: Complemental strand, 2017756 - 2017604
Alignment:
| Q |
79 |
tagcattacgtacaacaagaagaaatagattaaatacttnnnnnnnnn-tccaatgatttgtaaaagttataa-----gatgaacctgaaaaattagcaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2017756 |
tagcattacgtacaacaagaagaaatagattaaatacttaaaaaaaaaatccaatgatttgtaaaagttataacgaacgatgaacctgaaaaattagcaa |
2017657 |
T |
 |
| Q |
173 |
aatcatgcacatggctgtggcctcaaatcagttgctgcagctggtagtttttg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2017656 |
aatcatgcacatggctgtggcctcaaatcagttgctgcagctggtagtttttg |
2017604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University