View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10787_low_26 (Length: 223)
Name: NF10787_low_26
Description: NF10787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10787_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 27146333 - 27146520
Alignment:
| Q |
18 |
agacttactgaacgaggttggtgtctggttgaagttgtttttggataacgagaaccaccaagtggatgaagagaaggaagagttgagattgagaggaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146333 |
agacttactgaacgaggttggtgtctggttgaagttgtttttggataatgagaaccaccaagtggatgaagagaaggaagagttgagattgagaggaaag |
27146432 |
T |
|
| Q |
118 |
agacacccattgctacaaccaaattgttattgtttgatgtctttctttgtctttggaaggagaaagaggaaaaaggttcatgcaatgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146433 |
agacacccattgctacaaccaaattgttattgtttggtgtctttctttgtgtttggaaggagaaagaggaaaaaggttcatgcaatgt |
27146520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University