View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10789_13 (Length: 381)
Name: NF10789_13
Description: NF10789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10789_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 3e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 27 - 157
Target Start/End: Complemental strand, 9453938 - 9453808
Alignment:
| Q |
27 |
tcgaagaatataaagaaaatatgctctcaaagtttgatccttgctgctaacaaattttcccaccctcggacaaactaacaaccaatgtttgctcataaga |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
9453938 |
tcgaagagtataaagaaaatatgctctcaaagtttgatccttgctgctaacaaattttcccaccctcggacaaactaacaaacaatgtttgcttataaga |
9453839 |
T |
 |
| Q |
127 |
aaagaaaactaacagagattttgcttagaag |
157 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
9453838 |
aaagaaaattaacagagattttgcttagaag |
9453808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University