View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10789_21 (Length: 311)
Name: NF10789_21
Description: NF10789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10789_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 22 - 229
Target Start/End: Complemental strand, 30654367 - 30654160
Alignment:
| Q |
22 |
catcatcatatatcaaaaataccccataacaacataaactagacctgttaaggaaaaattagatagaattagaagtcagaacttcaactgaattgagttc |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30654367 |
catcaccatatatcaaaaataccccataacaacataaactagacctgttaaggaaaaattagatagaattagaagtcagaacttcaactgaattgagttc |
30654268 |
T |
 |
| Q |
122 |
aaaacagtaacgcacactagctaaacaacaacatcaaaccccaaaactgtaggcatctaatcacatttggaggcaactaagaaaagagtgcaacatgcca |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30654267 |
aaaacagtaacgcacgctagctaaacaacaacatcaaaccccaaaactgtaggcatctaatcacatttggaggcaactaagaaaagagtgcaacatgcca |
30654168 |
T |
 |
| Q |
222 |
aaagctat |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
30654167 |
aaagctat |
30654160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 253 - 281
Target Start/End: Complemental strand, 30654146 - 30654118
Alignment:
| Q |
253 |
agtcgagattgcgcagcagaggcagaaaa |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30654146 |
agtcgagattgcgcagcagaggcagaaaa |
30654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University