View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_high_16 (Length: 261)
Name: NF1078_high_16
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 23 - 245
Target Start/End: Complemental strand, 14447799 - 14447577
Alignment:
| Q |
23 |
gagatcaaaccaatgtgaaccgccattttcccaattcgactagttgaattgtttagttcggttcgatttttaaaacactatttcgagtgttaggaggtat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14447799 |
gagatcaaaccaatgtgaaccgccattttcccaattcgactagttgaattgtttaattcggttcgatttttaaaacactatttcgagtgttaggaggtat |
14447700 |
T |
 |
| Q |
123 |
caccatgtttttgggcgtatcatttatatgtaaaatgtaatagtcggcaaaacctttagataacatgttgcaatatgaggtacatcaatatagtcatcta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14447699 |
caccatgtttttgggcgtatcatttatatgtaaaatgtaatagtcggcaaaacctttagataacatgttgcaatatgaggtacatcaatatagtcatcta |
14447600 |
T |
 |
| Q |
223 |
tctctgtctccctctgtggtgct |
245 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14447599 |
tctctgtctccctctgtggtgct |
14447577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University