View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_high_20 (Length: 251)
Name: NF1078_high_20
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 51804549 - 51804761
Alignment:
| Q |
9 |
caccggccacccatatagtgttcatcttcttactcttgtaaccatccgaacataatggaaagtttctttgatcagatgaattagcattaaccggcatcat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804549 |
caccggccacccatatagtgttcatcttcttactcttgtaaccatgtgaacataatggaaagtttctttgatcagatgaattagcattaaccggcatcat |
51804648 |
T |
 |
| Q |
109 |
cacacataaaccaggattccctgcaaagctttcaactaaccctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaaagtttata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804649 |
cacacataaaccaggattccctgcaaagctttcaactaaccctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaaagtttata |
51804748 |
T |
 |
| Q |
209 |
gaattaggcaaca |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51804749 |
gaattaggcaaca |
51804761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University