View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_high_26 (Length: 203)
Name: NF1078_high_26
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 37658122 - 37658242
Alignment:
| Q |
1 |
gaaaaaggatagtgatggtggtgatgatgtccatctcattgacatgctctgtttcaactattttgtttctttatgtatacattttagtctaggaactagg |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658122 |
gaaaaaggatagtgatggtggtggtggtgttg--ctcattgatatgctctgtttcaactattttgtttctttatgtatacattttagtctaggaactagg |
37658219 |
T |
|
| Q |
101 |
aagaaaatggtgtaattcacaag |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37658220 |
aagaaaatggtgtaattcacaag |
37658242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University