View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_high_4 (Length: 381)
Name: NF1078_high_4
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 25 - 301
Target Start/End: Original strand, 37657966 - 37658242
Alignment:
| Q |
25 |
aagagaatcaaaagaagaaaacgctttggccccagactatagtaggatgggaaaacatcattcttcatcgtcagaaatggctggtgggggtgtgatcatt |
124 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
37657966 |
aagagaatcaaaagaagaaaacgctatggctccagattatagaaggatgggaaaacatcattcttcatcatcagaaatggctggtggaggtgtgatcatt |
37658065 |
T |
 |
| Q |
125 |
ggtgggttagttagtgcaacttttgctgttgttttttgctacattcgtgttacaaggaaaaaggatagtgatggtggtggtgttgttgctcattgacatg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
37658066 |
ggtgggttagttagtgcaacttttgctgttgttttttgctacattcgtgttacaaggaaaaaggatagtgatggtggtggtggtgttgctcattgatatg |
37658165 |
T |
 |
| Q |
225 |
ctctgtttcaactattttgtttctttatgtatacattttagtctaggaactaggaagaaaatggtgtaattcacaag |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658166 |
ctctgtttcaactattttgtttctttatgtatacattttagtctaggaactaggaagaaaatggtgtaattcacaag |
37658242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University