View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_14 (Length: 378)
Name: NF1078_low_14
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 33 - 246
Target Start/End: Original strand, 40383776 - 40383989
Alignment:
| Q |
33 |
aggattctgtagcttggttgatgaacggtcatcatgacgatgctaccgctctgagcaattctctgcaaaaccttcaccaccatgtaagcgcttgtagagt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383776 |
aggattctgtagcttggttgatgaacggtcatcatgacgatgctaccgctctgagcaattctctgcaaaaccttcaccaccatgtaagcgcttgtagagt |
40383875 |
T |
|
| Q |
133 |
caagtccagaggttggttcatccaagaacaaaatgattggatcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383876 |
caagtccagaggttggttcatccaagaacaaaatgattggatcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacg |
40383975 |
T |
|
| Q |
233 |
gtgaccttcatctc |
246 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40383976 |
gtgaccttcatctc |
40383989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University