View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_30 (Length: 303)
Name: NF1078_low_30
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 78 - 202
Target Start/End: Original strand, 896922 - 897046
Alignment:
| Q |
78 |
agaatattaatgatgtttagaagtttgatatgacaatagatattttgttctaactcacaagtattttgttccaacacttataaaaaacagtattgtgcct |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
896922 |
agaatattaatgatgtttagaagtttgatatgacaatagatattttgttctaactcacaagtattttgttccaacacttataaaaaacagtattgtgcct |
897021 |
T |
|
| Q |
178 |
tctttgttgcattgtggatgtatat |
202 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
897022 |
tctttgttgcattgtggatgtatat |
897046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 118 - 202
Target Start/End: Original strand, 1193133 - 1193217
Alignment:
| Q |
118 |
tattttgttctaactcacaagtattttgttccaacacttataaaaaacagtattgtgccttctttgttgcattgtggatgtatat |
202 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||||||||||| |||||| |||||||||||| |||||| || |||| |||| |
|
|
| T |
1193133 |
tattttgttccaagtcccaagtattttgttccaacacttataaattacagtaatgtgccttctttattgcatcgtagatgaatat |
1193217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 142 - 202
Target Start/End: Original strand, 1182207 - 1182267
Alignment:
| Q |
142 |
tttgttccaacacttataaaaaacagtattgtgccttctttgttgcattgtggatgtatat |
202 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
1182207 |
tttgttccaacacttataaaataccgtactgtgccttctttattgtattgtggatgtatat |
1182267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University