View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_31 (Length: 302)
Name: NF1078_low_31
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 39128785 - 39129070
Alignment:
| Q |
1 |
cttttatctgttggcaatgtatatatgttgttagagcggtggattctgttttcacttaactttgtttttcctgattagatttttaaatgtctattttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128785 |
cttttatctgttggcaatgtatatatgttgttagagcggtggattctgttttcacttacctttgtttttcctgattagatttttaaatgtctattttctt |
39128884 |
T |
 |
| Q |
101 |
ggtgtttattgtttgtgtttgcttttggaagtgtattgtagaagtttcttgaaggaagcttatttattgnnnnnnnnnnnnnnnncacaggcttttcttt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39128885 |
ggtgtttatcgtttgtgtttgcttttggaagtgtattgtagaagtttcttgaaggaagcttatttattgttttttggttttttttcacaggcttttcttt |
39128984 |
T |
 |
| Q |
201 |
ggtgtgaaggctactgttgaaaaatgatttttaagggttctgataagtcaaagtactgtgctgttggtgatggtgatgatgtccat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
39128985 |
ggtgtgaaggctactgttgaaaaatgatttttaagggttctgataagtcaaagtactgtgctgttggtggtggtgatgatggccat |
39129070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 208 - 274
Target Start/End: Complemental strand, 39496094 - 39496028
Alignment:
| Q |
208 |
aggctactgttgaaaaatgatttttaagggttctgataagtcaaagtactgtgctgttggtgatggt |
274 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
39496094 |
aggctaccgttgaaaaatggcttttaagggttctgataagtcaaagttctgtggtgttggtggtggt |
39496028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University