View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_34 (Length: 294)
Name: NF1078_low_34
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 45 - 237
Target Start/End: Complemental strand, 16140099 - 16139905
Alignment:
| Q |
45 |
actactttcgcaatttttatttgatcatgtaaggattggttatctatgaattgacttttattttttcactggttacctaattaagnnnnnnnnn--gttt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16140099 |
actactttcgcaatttttatttgatcatgtaaggattggttatctatgaattgacttttattttttcactggttacctaattaagaaaaaaaaaaagttt |
16140000 |
T |
 |
| Q |
143 |
aaaaggaggaaagaagccaccaaaaatgataatcaattgcagataaagattaatgtcactttttgaatagaatgaagttgatgttaacgtctctg |
237 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16139999 |
aaaaggagtaaagatgccaccaaaaatgataatcaattgcagataaagattaatgtcactttttgaatagaatgaagttgatgttaacgtctctg |
16139905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University