View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_35 (Length: 290)
Name: NF1078_low_35
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 53 - 174
Target Start/End: Original strand, 33427083 - 33427204
Alignment:
| Q |
53 |
agagactgaaaaagaaacgaggcattacactatccctattattagtcaggtgtgaaaacattttggcactttcttttggttgataattcttttgtcagct |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33427083 |
agagactgaaaaagaaacgaggcattacactatccctattattagtcaggtgtgaaaacattttgtcactttcttttggttgataattcttttgtcagct |
33427182 |
T |
 |
| Q |
153 |
gaatggaaattcatcatctaaa |
174 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33427183 |
gaatggaaattcatcatctaaa |
33427204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University