View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_43 (Length: 268)
Name: NF1078_low_43
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 43321867 - 43321630
Alignment:
| Q |
1 |
ttttggataatgacacgagaccttgaaaataaagtctcacgataatccttaagaattattcatgtcaaatattactaattcannnnnnnnagcaagggcg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43321867 |
ttttggataacgacacgagaccttgaaaataaagtctcacgataatccttaagaattattcatgtcaaatattactaattcattttttttagcaagggcg |
43321768 |
T |
|
| Q |
101 |
tggtttggttgaatcatcatagcttatatatgataatctttaccaaggcaacaccataaaattttaatttttacacttacacgtgcattggatgattaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43321767 |
tggtttggttgaatcatcatagcttatatatgataatctttaccaaggcaacaccataaaattttaatttttacacttacacgtgcattggatgatt--a |
43321670 |
T |
|
| Q |
201 |
gagcaatcacaattcacaatctatttcattggtaggatag |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43321669 |
gagcaatcacaattcacaatctatttcattggtaggatag |
43321630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University