View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_46 (Length: 261)
Name: NF1078_low_46
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 240
Target Start/End: Complemental strand, 31685225 - 31685007
Alignment:
| Q |
22 |
cacagacaatacaaaaataaatgttgtaacttgtaaggctagaaagtgtattatttcattatgagttcttgttatagtagaatactgagcttgatgatag |
121 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31685225 |
cacacacaatccaaaaataaatattgtaacttgtaaggctagaaaatgtattattccattatgagttcttgttatagtagaatactgagcatgatgatag |
31685126 |
T |
|
| Q |
122 |
gaagggtattattcaatcattgtattaagacttaaatttctattacttcatcttcaggctttgctgcaggctcttggtgataggaatggtattaaccgtt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31685125 |
gaagggtattattcaatcattgtattaagacttaaatttctattacttcatctccaggctttgctgcaggctcttggtgataggaatggtattaaccggt |
31685026 |
T |
|
| Q |
222 |
ttggtaacttctctgctcc |
240 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31685025 |
ttggtaacttctctgctcc |
31685007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 157 - 240
Target Start/End: Complemental strand, 46984441 - 46984358
Alignment:
| Q |
157 |
atttctattacttcatcttcaggctttgctgcaggctcttggtgataggaatggtattaaccgttttggtaacttctctgctcc |
240 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
46984441 |
atttctgttacttcgtctccaggctttgctgcaggctcttggtgataggaagggtattaaccggtttggtaacttctctgctcc |
46984358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 44 - 110
Target Start/End: Complemental strand, 46985168 - 46985102
Alignment:
| Q |
44 |
gttgtaacttgtaaggctagaaagtgtattatttcattatgagttcttgttatagtagaatactgag |
110 |
Q |
| |
|
|||||||||||| |||| | || |||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
46985168 |
gttgtaacttgttaggccataatgtgtattattccattgtgagtttttgttatagtagaatactgag |
46985102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University