View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_49 (Length: 251)
Name: NF1078_low_49
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 26549806 - 26550049
Alignment:
| Q |
1 |
taaacttattctcagtagttatgcatattatcaatttattaagcaagctatcaatatcactttcttctgaaatataactatgttagga---agtgtacgt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
26549806 |
taaacttattctcagtagttatgcatattatcaatttattaagcaagctatcaatatcactttcttctgaaatataactatgttagtagtaagtgtacgt |
26549905 |
T |
 |
| Q |
98 |
gactcaatgcagcttctttgtctatcacgataagtctaatatataactcttgcttgctcttcttgaggaatcttagtagttagtatgatatatgttcgta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26549906 |
gactcaatgcagcttctttgtctatcacgataagtctaatatataactcttgcttgctcttcttgaggaatcttagtagttagtatgatatatgttcgta |
26550005 |
T |
 |
| Q |
198 |
ccacgtaagtgtgtaactttggtgcatcataaaattagtctgtg |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
26550006 |
ccacgtaagtctgtaactttggtgcatcataaaattagtttgtg |
26550049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 26541919 - 26541977
Alignment:
| Q |
1 |
taaacttattctcagtagttatgcatattatcaatttattaagcaagctatcaatatcac |
60 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
26541919 |
taaaattattctcagtagttttgcatattatcaa-ctattaagtaagcaatcaatatcac |
26541977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University