View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1078_low_54 (Length: 250)
Name: NF1078_low_54
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1078_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 42 - 243
Target Start/End: Original strand, 29170073 - 29170275
Alignment:
| Q |
42 |
ggcctcaaaattttcactaattttatgattggttaatttagtaaaaaattaatcaatcacataaatacatataacatttacaagtataaaa-ctaattaa |
140 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29170073 |
ggcctaaaaattttcactaattttataattggttaatttagtaaaaaactaatcaatcacatgaatacatataacatttacaagtataaaaactaattaa |
29170172 |
T |
 |
| Q |
141 |
agttcttagagctctaattttatttaaattttactttaattctatagatttgtggtattccttttagtcttcttaatcggatcaacttttgatattcatc |
240 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
29170173 |
agttcatagagctctaattttatttaaattttactttaattctatagatttgtggtattcgttttagtttttttaatcggatcaacttttgatattcatc |
29170272 |
T |
 |
| Q |
241 |
tca |
243 |
Q |
| |
|
||| |
|
|
| T |
29170273 |
tca |
29170275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University