View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1078_low_59 (Length: 203)

Name: NF1078_low_59
Description: NF1078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1078_low_59
NF1078_low_59
[»] chr2 (1 HSPs)
chr2 (1-123)||(37658122-37658242)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 37658122 - 37658242
Alignment:
1 gaaaaaggatagtgatggtggtgatgatgtccatctcattgacatgctctgtttcaactattttgtttctttatgtatacattttagtctaggaactagg 100  Q
    ||||||||||||||||||||||| || |||    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37658122 gaaaaaggatagtgatggtggtggtggtgttg--ctcattgatatgctctgtttcaactattttgtttctttatgtatacattttagtctaggaactagg 37658219  T
101 aagaaaatggtgtaattcacaag 123  Q
    |||||||||||||||||||||||    
37658220 aagaaaatggtgtaattcacaag 37658242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University