View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10790_low_1 (Length: 300)
Name: NF10790_low_1
Description: NF10790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10790_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 290
Target Start/End: Original strand, 9866486 - 9866759
Alignment:
| Q |
20 |
atgttaggttttcaaaatgttctttaaacccagcaaacaagtttagaaaacatgagaaaaactttgcttagtccacataacaaaaacacggacagacaga |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
9866486 |
atgttaggttttcaaaatgttctt-aaacccaacaaacaagtttagaaaacatgagaaaaaatttgctcagtccacataacaaaaacacgaacagacaga |
9866584 |
T |
|
| Q |
120 |
cagatagatagacggatagatagg----gattactaacctcagatactgaaatggtaggaagaagagtactaagatgaagatatatacgttgaagaagac |
215 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866585 |
cagatagacagacagatagatagatagagattactaacctcggatactgaaatggtaggaagaagagtactaagatgaagatatatacgttgaagaagac |
9866684 |
T |
|
| Q |
216 |
cagtgccacaattgcaagctctttcactaccttctgtatttcgcattctttcttcatggcaattctcaacctttg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866685 |
cagtgccacaattgcaagctctttcactaccttctgtatttcgcattctttcttcatggcaattctcaacctttg |
9866759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University