View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10791_high_2 (Length: 241)
Name: NF10791_high_2
Description: NF10791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10791_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 52556802 - 52556663
Alignment:
| Q |
1 |
tttgtatccaaggtactagattgtttacactaacccagatgaaagcaaaccactgagatatgctctatacccaatacaaaagattgctctcttctgccac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52556802 |
tttgtatccaaggtactagattgtttacactaacccagatgaaagaaaaccactgagatatgctctatacccaatacaaaagattgctctcttctgccgc |
52556703 |
T |
|
| Q |
101 |
atcacaaatccatgaaacacacagaaaagtaaaaatctca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52556702 |
atcacaaatccatgaaacacacagaaaagtaaaaatctca |
52556663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University