View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10791_low_11 (Length: 211)
Name: NF10791_low_11
Description: NF10791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10791_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 44014315 - 44014496
Alignment:
| Q |
17 |
gacatcagaacgaagaagggtgagagtatactgagaaccccattgaaaaatggggaacaagaattgaagggtaagaagaaactttgtaaaagatggttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44014315 |
gacatcagaacgaagaagggtgagagtatactgagaaccccattgaaaaatggggaacaagaattgaagggtaagaagaaactttgtaaaagatggttgg |
44014414 |
T |
 |
| Q |
117 |
tttttgaaacggtgtaaaggatcatcagggaagaagatttcagagagtctgtgtttgagtttgttgagtgatgttctctctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44014415 |
tttttgaaacggtgtaaaggatcatcggggaagaagatttcagagagtctgtgtttgagtttgttgagtgatgttctctctg |
44014496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 43 - 166
Target Start/End: Complemental strand, 3172862 - 3172739
Alignment:
| Q |
43 |
tatactgagaaccccattgaaaaatggggaacaagaattgaagggtaagaagaaactttgtaaaagatggttggtttttgaaacggtgtaaaggatcatc |
142 |
Q |
| |
|
||||||||| ||||||||||||||| || |||| | ||||||| | |||||||||||||| || || | |||||||||||| | || ||||| ||||| |
|
|
| T |
3172862 |
tatactgaggaccccattgaaaaatcggaaacatgtattgaagagccagaagaaactttgtgaaggaagtttggtttttgaatccatgaaaagggtcatc |
3172763 |
T |
 |
| Q |
143 |
agggaagaagatttcagagagtct |
166 |
Q |
| |
|
||| || ||||||||||||||||| |
|
|
| T |
3172762 |
aggaaaaaagatttcagagagtct |
3172739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University