View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10791_low_13 (Length: 202)

Name: NF10791_low_13
Description: NF10791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10791_low_13
NF10791_low_13
[»] chr6 (2 HSPs)
chr6 (58-115)||(31072677-31072735)
chr6 (58-115)||(31024780-31024837)
[»] chr8 (1 HSPs)
chr8 (58-115)||(33559833-33559890)


Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 58 - 115
Target Start/End: Complemental strand, 31072735 - 31072677
Alignment:
58 cctcttctcgttttaaccaaattttgaacaa-tttacaattttctatgcttcattcatt 115  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
31072735 cctcttctcgttttaaacaaattttgaacaaatttacaattttctatgcttcattcatt 31072677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 58 - 115
Target Start/End: Complemental strand, 31024837 - 31024780
Alignment:
58 cctcttctcgttttaaccaaattttgaacaatttacaattttctatgcttcattcatt 115  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||    
31024837 cctcttctcattttaaccaatttttgaacaatttacaattttctatacttcattcatt 31024780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 115
Target Start/End: Complemental strand, 33559890 - 33559833
Alignment:
58 cctcttctcgttttaaccaaattttgaacaatttacaattttctatgcttcattcatt 115  Q
    ||||||||||| ||| |||||| |||||| |||||||||||||| |||||||||||||    
33559890 cctcttctcgtcttacccaaatattgaaccatttacaattttctctgcttcattcatt 33559833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University