View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10792_8 (Length: 433)
Name: NF10792_8
Description: NF10792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10792_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 8e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 235 - 433
Target Start/End: Complemental strand, 24401121 - 24400924
Alignment:
| Q |
235 |
gtgagactgagaatacaaacaaactcatttttattgttatcaggatatttaccaacttatgcttatttgctaaagtgcccttagttgctggttgttgatc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24401121 |
gtgagactgagaatacaaacaaactcatttttattgttatcag-atatttaccaacttatgcttatttgctaaagtgcccttagttgctggttgttgatc |
24401023 |
T |
|
| Q |
335 |
acgtttattttacacacatgccataaggaaccaacaaccactcacactacccttcctttgtttttcaacaaaacactcacttaccaatatatatataat |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24401022 |
acgtttattttacacacatgccataaggaaccaacaaccacttacactacccttcctttgtttttcaacaaatcactcacttaccaatatatatataat |
24400924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 26 - 216
Target Start/End: Original strand, 38624642 - 38624832
Alignment:
| Q |
26 |
ggagagtttgaatctcttcatgatgcttgggagaggttcaagctgttattaaagagatgcctatgacttgaatgagaaaaatgagttgtaaatatttacc |
125 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38624642 |
ggagagtctgaatctcttcataatgcttgggagaggttcaagctgttattaaagagatgcctatgacttgagtgagaaaaatgagttgtaaatatttacc |
38624741 |
T |
|
| Q |
126 |
gaagggctaagacctaaccagagaatgcacttagatgccttagttggggtagtatgagagtgaaaactgaccttgaagtttagaccctgac |
216 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38624742 |
gaatggctaagacctaaccagagaatgcacttagatgcctttgttggggtagtatgagagtgaaaactgaccttgaagtttagaccctgac |
38624832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 35 - 81
Target Start/End: Complemental strand, 19863528 - 19863482
Alignment:
| Q |
35 |
gaatctcttcatgatgcttgggagaggttcaagctgttattaaagag |
81 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
19863528 |
gaatctctctatgatgcttgggagaggttcaaactgttattgaagag |
19863482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 36 - 81
Target Start/End: Original strand, 64542 - 64587
Alignment:
| Q |
36 |
aatctcttcatgatgcttgggagaggttcaagctgttattaaagag |
81 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
64542 |
aatctctctatgatgcttgggagaggttcaaactgttattgaagag |
64587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University