View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10792_low_2 (Length: 297)
Name: NF10792_low_2
Description: NF10792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10792_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 284
Target Start/End: Original strand, 24098344 - 24098612
Alignment:
| Q |
16 |
aatattttggtaatagactcttttgtaattggtttagggtttggtattacttctccctcctaaaccttatactaataagtgaggatatgttgtcatttgt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24098344 |
aatattttggtaatatactcttttgtaattggtttagggtttggtattacttctccctcctaaaccctatactaataagtgaggatatgttgtcatttgt |
24098443 |
T |
|
| Q |
116 |
agcaatgagcattggggtgatggactcttttgtaattggtttgcttatgataatattgatcagagccatatacaacaaataaattggatcctcttatcct |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24098444 |
agaaatgagcattggggtgatggactcttttgttattggtttgcttatgataatattgatcagagccatatacaacaaataaattggatcctcttctcct |
24098543 |
T |
|
| Q |
216 |
cctcactttctctctctcaaatttgcatctatatctttcttgatctacgttctctctcacttgattttt |
284 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24098544 |
cctcactttctccttctcaaatttgcatctatatctttcttgatctacgttctctctcacttgattttt |
24098612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University