View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10795_high_2 (Length: 257)
Name: NF10795_high_2
Description: NF10795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10795_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 48801206 - 48800956
Alignment:
| Q |
1 |
tctgatatggtaaacaaagtatagcctattgcgccatccacatatatctagtagtttatacactccagatgtctagtctctggcttgaggaatgtgttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801206 |
tctgatatggtaaacaaagtatagcctattgagccatccacatatatctagtagtttatacactccagatgtctagtctctggcttgaggaatgtgttga |
48801107 |
T |
 |
| Q |
101 |
gagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaac--tagttcgcctatttctctttctaacttttgggtattcaaaccaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801106 |
gagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaacattagttggcctatttctctttctaacttttgggtattcaaaccaa |
48801007 |
T |
 |
| Q |
199 |
gtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801006 |
gtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctc |
48800956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University