View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10795_low_10 (Length: 226)
Name: NF10795_low_10
Description: NF10795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10795_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 5 - 210
Target Start/End: Original strand, 48754956 - 48755161
Alignment:
| Q |
5 |
tttaatgtggctatggattgtggaccatacttttctaaagattggtcgtaatttatttacttatctaagagtaaatgtttttactcttttgtacagatca |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48754956 |
tttaatgtgactatggattgtggaccatacttttctaaagattggtcgtaatttatttacttatctaagagtaaatgtttttactcttttgtacaaatca |
48755055 |
T |
 |
| Q |
105 |
ttttgtacttgtccgagtttatatattgatgaaattgatttgaattttcttctaatgcttaatgcttttggtatttatcatatcattcatatgtgatggt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48755056 |
ttttgtacttgtccgagtttatatattgatgaaattgatttgaattttcttctaatgcttaatgcttttggtatttatcatatcattcatatgtgatggt |
48755155 |
T |
 |
| Q |
205 |
gctttc |
210 |
Q |
| |
|
|||||| |
|
|
| T |
48755156 |
gctttc |
48755161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Original strand, 44453160 - 44453206
Alignment:
| Q |
53 |
taatttatttacttatctaagagtaaatgtttttactcttttgtaca |
99 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||||| |||| |
|
|
| T |
44453160 |
taatttatttacttatttaagagaaaatgtttttattcttttttaca |
44453206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University