View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10795_low_3 (Length: 370)
Name: NF10795_low_3
Description: NF10795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10795_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 365
Target Start/End: Complemental strand, 229826 - 229476
Alignment:
| Q |
1 |
tccggtaccgatgatgtaagttcacttctctctacttgatcactatttattattagcttttaatattggacttaacacattccttacaaaatcaacgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
229826 |
tccggtaccgatgatgtaagttcacttctctctacttgatcactatttattattagcttttaatattggacttaacatat-ccttacaaaatcaacgttt |
229728 |
T |
|
| Q |
101 |
accatgtcatattaatattttttatattagatctaactcattatttataaatcggtatataacatgatgcgatgcgtgcatctctttgtaaaggtcttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229727 |
accatgtcatattaatattttttatattagatctaactcattatttataaatcggtatataacatgatgcgatgcgtgcatctctttgtaaaggtcttgg |
229628 |
T |
|
| Q |
201 |
tattttcaatactaataaggttgatccccatatcatacacaaccctttagtttgactcatatcaaagctttatttcgagatcaaatatttcggttcgtaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229627 |
tattttcaatactaataaggttgatccccatatcatacacaaccctttagtttgactcatatcaaagctttatttcgagatcaaatatttcggttcgtaa |
229528 |
T |
|
| Q |
301 |
atgtatatgttgcctttcctaattaaaaaacatgtttatttataaactaagcttcctttgcttct |
365 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
229527 |
a-------------tttcctaattaaaaaacatgtttatgtataaactaagcttccttttcttct |
229476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University