View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10795_low_4 (Length: 303)
Name: NF10795_low_4
Description: NF10795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10795_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 23 - 157
Target Start/End: Complemental strand, 45545327 - 45545196
Alignment:
| Q |
23 |
ttacagtagttagatatgggttctgcatctgctggggacaagatggacgctgatttcgatgaagagacacctttcagttcaacttcaccttcatctgcat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45545327 |
ttacagtagttagatatgggttctgcatctgctggggacaagatggacgctgatttcgatgaagagacacctttcagttcaacttcaccttcatctacat |
45545228 |
T |
|
| Q |
123 |
ctgctaatacttcttcttcttctgttaaaccacac |
157 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
45545227 |
ctgctaatacttcttc---ttctgttaaaccacac |
45545196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 216 - 293
Target Start/End: Complemental strand, 45545137 - 45545060
Alignment:
| Q |
216 |
attcccgcactagactaatcagcaaaagtatatatatcgtcttaatcaaagctaagatcaacatcttactcccctttg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545137 |
attcccgcactagactaatcagcaaaagtatatatatcgtcttaatcaaagctaagatcaacatcttactcccctttg |
45545060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University