View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10796_low_1 (Length: 250)

Name: NF10796_low_1
Description: NF10796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10796_low_1
NF10796_low_1
[»] chr7 (1 HSPs)
chr7 (1-240)||(33504848-33505087)


Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 33505087 - 33504848
Alignment:
1 tattactatgcatgttaactatatatgcaaatattaattaatattttggttactaaattattaggaaactgaaaatctcggtagagaaattggtggaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
33505087 tattactatgcatgttaactatatatgcaaatattaattaatattttggttactaaattattaggaaactggaaatctcggtagagaaattggtggaaga 33504988  T
101 ttttgaacaaggatggactccagatgcaggaaactattgcaaaaatttagttgaatttggtagtgggaaggctctaactcaaatgtgccgtaacatagag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33504987 ttttgaacaaggatggactccagatgcaggaaactattgcaaaaatttagttgaatttggtagtgggaaggctctaactcaaatgtgccgtaacatagag 33504888  T
201 gaagagatcaataatggttcatttagtaggttatcctatg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
33504887 gaagagatcaataatggttcatttagtaggttatcctatg 33504848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University