View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_high_14 (Length: 240)
Name: NF10798_high_14
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_high_14 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 74 - 240
Target Start/End: Original strand, 29857483 - 29857649
Alignment:
| Q |
74 |
ctttttgaactatctgtcagcatgtatataatgccagtatctacatatactcacttgggtgactcgatggtgctaacttggtaccttagagtgtattcag |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||| || ||||| |
|
|
| T |
29857483 |
ctttttgaactatctgtcagcatgtatataatgccagtatctacatatactcacttgggtggctcgatggtgttaacttggtatcttagagagtgttcag |
29857582 |
T |
|
| Q |
174 |
cccaaggtctcagattcaatctggtgtaaattttggtatgctagtctatacataggttttctttggc |
240 |
Q |
| |
|
||||||||| ||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29857583 |
cccaaggtcacagattcgatccggtgtaaattttggtatgctagtctatagataggttttctttggc |
29857649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 25 - 76
Target Start/End: Original strand, 29857402 - 29857453
Alignment:
| Q |
25 |
ggttcgtataatataatttcaacattagtaatagtgtttgattgatacactt |
76 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29857402 |
ggttcctataatataatttcaacattagtaatagtgtttgattgatacactt |
29857453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University