View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_10 (Length: 346)
Name: NF10798_low_10
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 3495069 - 3495345
Alignment:
| Q |
1 |
acagagacactatcattactactactacaacaacactcaacagtagaagaagaaaagggtcattgcgtgtatcaatggcggcggtgaaagaagcgatggt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3495069 |
acagagacactatcattactactacaacaacaacactcaacagtagaagaagaaaaggttcattgcgtgtatcaatggcggcggtgaaagaagtgatggt |
3495168 |
T |
|
| Q |
101 |
ggtaatgnnnnnnnnnnnnnnnnnnnnacttcagttaggtattgctgagttttacgatgagtcttctggtatatgggagaatatttggggtgatcatatg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3495169 |
ggtaatggaagaagaagagaagaagaaacttcagttaggtattgctgagttttacgatgagtcttctggtatatgggagaatatttggggtgatcatatg |
3495268 |
T |
|
| Q |
201 |
catcatggtttttatgaccctgattctactgtttctgtttctgatcatcgtgctgctcagatccgtatgattgaaaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3495269 |
catcatggtttttatgaccctgattctactgtttctgtttctgatcatcgtgctgctcagatccgtatgattgaaaa |
3495345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University