View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_18 (Length: 291)
Name: NF10798_low_18
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 4957978 - 4957722
Alignment:
| Q |
17 |
agagtgtgtgtttgcttgatcactattgaagacaatattggctaaagagatgggttgtatgttcaaatcttgttatcttgcgtccttttcaattttgtct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4957978 |
agagtgtgtgtttgcttgatcactattgaagacaatatcggctaaagagatgggttgtatgttcaaatcttgttatcttgcgtccttttcaattttgtct |
4957879 |
T |
|
| Q |
117 |
tgcctgtcttattttgcctctttaagaacctttgtagttggcatatttacataaagaataatatattaccatttttgctcccagagagagaacatacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
4957878 |
tgcctgtcttattttgcctctttaagaacctttgtagttggcatatttacataaag---aatatattaccatatttgctcccacagagagaacatacaaa |
4957782 |
T |
|
| Q |
217 |
caatcaaattaatgaaagaaactctctcttctcgttctaatagtgattaatattgctcctct |
278 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4957781 |
caatcaaattaatgaaagaaa--ctctcttctcgttctaatagtgattaatattgctcctct |
4957722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University