View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_25 (Length: 246)
Name: NF10798_low_25
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 778364 - 778604
Alignment:
| Q |
1 |
cctcaacatgcacaatctctatgtctcaccttcttcttcaaccttacatctttcaaaccacataaccaaaccaaaatttcacccttttcaaaattctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
778364 |
cctcaacatgcacaatctctatgtctcaccttcttcttcaaccttacatctttcaaaccacataaccaaaccaaaatttcacccttttcaaaattctcat |
778463 |
T |
|
| Q |
101 |
tctcacaatttttcttcttcaccacttagactcaccattgatggatttgcatgtccatcttcttctttcttccaaactgttggaaaatcttcacctttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
778464 |
tctcacaatttttcttcttcaccacttagactcaccattgatggatttgcatgtccatcttcttctttcttccaaactgttggaaaatcttcacctttct |
778563 |
T |
|
| Q |
201 |
tcatttcaaatccaaaaatggattcttttagagtctctgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
778564 |
tcatttcaaatccaaaaatggattcttttagagtctttgct |
778604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University