View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_26 (Length: 245)
Name: NF10798_low_26
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 29857841 - 29858064
Alignment:
| Q |
1 |
ttcctaaaattcatagaaaccaaataaatgtgcttttgcagaacatgaaatgaaacagtagattgcaggccatgcccaaatcacatatgccatgttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29857841 |
ttcctaaaattcatagaaaccaaataaatgtgcttttgcagaacatgaaatgaaacagtagattgcaggccatgcccaaatcacatatgccatgctattt |
29857940 |
T |
|
| Q |
101 |
ccactttcttatagatgaaatttcaagacttttagagaataaccaagctccaatccttgagaagactatgatctaaatctctcttcatctaaggcaaata |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29857941 |
ccactttcttatggatgaaatttcaagacttttagagaataaccaagcttcaatctctgagaagactatgatctaaatctctcttcatctaagggaaata |
29858040 |
T |
|
| Q |
201 |
agctccatccaaatgtgcttctag |
224 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
29858041 |
agctccatccaaaagtgcttctag |
29858064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University