View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_28 (Length: 241)
Name: NF10798_low_28
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 39224170 - 39224384
Alignment:
| Q |
14 |
aaataatgcagctggtcaggagagatttagaacactgacaagttcttactacagaggggctcaaggaatcatcatgggcaagtttctattcttccnnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39224170 |
aaataatgcagctggtcaggagagatttagaacactgacaagttcttactacagaggggctcaaggaatcatcatgggcaagtttctattcttccttttt |
39224269 |
T |
 |
| Q |
114 |
nnngcctctgaattcttccaatagtacatttatctattgtgttatgtgaaatgcctcagaatattgatgaccatgatatattcagtggatagaattgaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39224270 |
tttgcctctgaattcttccaatagtacatttatttattgtgttatgtgaaatgcctcagaatattgatgaccatgatatattcagtggatagaattgaat |
39224369 |
T |
 |
| Q |
214 |
gccattgctgtgttc |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39224370 |
gccattgctgtgttc |
39224384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 44038402 - 44038474
Alignment:
| Q |
19 |
atgcagctggtcaggagagatttagaacactgacaagttcttactacagaggggctcaaggaatcatcatggg |
91 |
Q |
| |
|
||||||||||||| |||||||| |||||||| || |||||||| || |||| |||||||| ||||| ||||| |
|
|
| T |
44038402 |
atgcagctggtcaagagagattcagaacactaactagttcttattatcgaggcgctcaagggatcattatggg |
44038474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 27496693 - 27496758
Alignment:
| Q |
20 |
tgcagctggtcaggagagatttagaacactgacaagttcttactacagaggggctcaaggaatcat |
85 |
Q |
| |
|
||||||||| ||||| || || ||||| || |||||||||||||| ||||| || ||||||||||| |
|
|
| T |
27496693 |
tgcagctgggcaggaaaggttcagaacgctaacaagttcttactatagaggcgcgcaaggaatcat |
27496758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University