View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_29 (Length: 240)
Name: NF10798_low_29
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 225
Target Start/End: Complemental strand, 40411000 - 40410786
Alignment:
| Q |
9 |
tatgttctaagttagatcataccttttatccgttgtcagagatagtatatgtagctaactgatattattaatattgtcaagatgatgttgaaaggagtac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40411000 |
tatgttctaagttagatcataccttttatccgttgtcagaggtagtatatgtagctaactgatattattaatattgtcaagatgatgttgatc--agtac |
40410903 |
T |
|
| Q |
109 |
taaaaatgaagtccaaactttgattccagctaacaattttgtcttgctatcaactaaaaaatcatacttttatctctcaaatttattgcatctgcaaaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410902 |
taaaaatgaagtccaaactttgattccagctaacaaatttgtcttgctatcaactaaaaagtcatacttttatctctcaaatttattgcatctgcaaaag |
40410803 |
T |
|
| Q |
209 |
agattatggtgcatatt |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40410802 |
agattatggtgcatatt |
40410786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University