View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_36 (Length: 229)
Name: NF10798_low_36
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 777524 - 777638
Alignment:
| Q |
7 |
cttttaccaatacaaataacatttgtatatttcgggcgtcttattacagatttgcttcgttaacaactttggatttgaggattagacatcaactcgatca |
106 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
777524 |
cttttaccaatacaaataagatttatatatttcgggcgtcttattaaacatttgcttcgttaacgactttggatttgaggattagacatcaactcgatca |
777623 |
T |
 |
| Q |
107 |
taaaaactatccaat |
121 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
777624 |
taaaaactatccaat |
777638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University