View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_39 (Length: 227)
Name: NF10798_low_39
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_39 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 46471256 - 46471483
Alignment:
| Q |
1 |
catccaaaaatgaccggttcacatattagagctatactcattactc-actgtaatttttggagtttcctgcttagaaccttgggttatactcggtttcct |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46471256 |
catccaaaaatgaccggttcacagattagagctatactcattactctactgtaatttttggagtttcctgcttagaaccttgggttatactcggtttcct |
46471355 |
T |
 |
| Q |
100 |
gattagaattgggacaaactcatattgtaaatgtcattctattagattaatatctatagttttagtattggtatgatgccgaaattagccatcatcaaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46471356 |
gattagaattgggacaaactcatattgtaaatgtcattctattagattaatatctatagttttagtattggtatgatgccgaaattggccatcatcaaga |
46471455 |
T |
 |
| Q |
200 |
aacataaatgtgatagggatatgcactc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
46471456 |
aacataaatgtgatagggatatgcactc |
46471483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University