View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10798_low_44 (Length: 201)
Name: NF10798_low_44
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10798_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 3362170 - 3361996
Alignment:
| Q |
15 |
gaacaagaacaagatgttggtttggtttcacttgtactttctccattgatcacattatttatttatttatt----cctttttgttctctgttgcatttct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3362170 |
gaacaagaacaagatgttggtttggtttcacttgtactttctccattgatcacattatttatttatttatttattcctttttgttctctgttgcatttct |
3362071 |
T |
|
| Q |
111 |
attgttgatgcttctttggattaataatagtattagataaattcgtgatgtgttttgttatgttgttattgtttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3362070 |
attgttgatgcttctttggattaataatagtattagataaattcgtgatgtgttttgttatgttgttactgtttt |
3361996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University