View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10799_low_11 (Length: 238)
Name: NF10799_low_11
Description: NF10799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10799_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6716826 - 6717049
Alignment:
| Q |
1 |
tacttatattttgtaaattatgaacctatgatgattgtttggtcctcaataatttcatannnnnnn-attacaaaaaacataattctgcggctgaattgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6716826 |
tacttatattttgtaaattatgaacctatgatgattgtttggtcctcaataatttcatattttttttattacaaaaaacataattctgcggctgaattgc |
6716925 |
T |
 |
| Q |
100 |
tacaacatcgacacgtgtcctcttgttttgtacgctattgtttctctttggccacacaaaagaaaaagcgcgtttgaggctccacctccttatatatacc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6716926 |
tacaacatcgacacgtgtcctcttgttttgtacgctattgtttctctttggccacacaaaagaaaaagcgcgtttgaggctccacctccttatatatacc |
6717025 |
T |
 |
| Q |
200 |
ataat-ccatttccctcactcatc |
222 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
6717026 |
ataatcccatttccctcactcatc |
6717049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University