View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10799_low_12 (Length: 232)
Name: NF10799_low_12
Description: NF10799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10799_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 27663033 - 27662823
Alignment:
| Q |
1 |
tatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagctacgtttcttatgtttcttgatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27663033 |
tatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagctacgtttcttatgtttcttgatgat |
27662934 |
T |
|
| Q |
101 |
atacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaagggtgaagggtctggaaagctttatgcggatttacctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27662933 |
atacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaagggtgaagggtctggaaagctttatacggatttacctta |
27662834 |
T |
|
| Q |
201 |
agtgcggatct |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
27662833 |
agtgcggatct |
27662823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 211
Target Start/End: Complemental strand, 8309927 - 8309808
Alignment:
| Q |
92 |
cttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaagggtgaagggtctggaaagctttatgcgga |
191 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||| ||||||| || |||||| |||| |||| |||||| |||| |
|
|
| T |
8309927 |
cttgatgatattgagatttcaaatgagaacgtggaggcaatgagagctgatatggaatcaatggaggttagagtgaagtgtctcgaaaactttattcgga |
8309828 |
T |
|
| Q |
192 |
tttaccttaagtgcggatct |
211 |
Q |
| |
|
|||| || ||| |||||||| |
|
|
| T |
8309827 |
tttatctcaagcgcggatct |
8309808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 77
Target Start/End: Complemental strand, 8310054 - 8309990
Alignment:
| Q |
13 |
gttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagcta |
77 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||| | | | |||||||||||||||||| |||| |
|
|
| T |
8310054 |
gttggctgagcgggataatcttgatgaagaagaagtggatcaatgggcgataaacaatgctgcta |
8309990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University