View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10799_low_7 (Length: 314)
Name: NF10799_low_7
Description: NF10799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10799_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 79 - 231
Target Start/End: Complemental strand, 4885013 - 4884861
Alignment:
| Q |
79 |
gctacgttggttgtgtcttctgatcagtacttgactgagattctgtctgagaaggtttgtagtcagagagatagaagaagaggacgtgttgctgtgtgga |
178 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4885013 |
gctacgttggttgtttcttctgatcagtacttgactgagattctgtctgagaaggtttgtagtcagagagacagaagaagaggacgtgttgctgtgtgga |
4884914 |
T |
 |
| Q |
179 |
gacctcatttggagagtatttctgagtcaccaacaaatcatctataacggttg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884913 |
gacctcatttggagagtatttctgagtcaccaacaaatcatctataacggttg |
4884861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University