View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10800_high_2 (Length: 269)
Name: NF10800_high_2
Description: NF10800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10800_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 32345915 - 32345670
Alignment:
| Q |
9 |
agcaaagggatcattttgaataggacttgttatcattttagggataaatttgaaccctcacaaaattttcatccataaaatttgcactctctcaaatcac |
108 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32345915 |
agcaaatggattattttgaataggacttgttatcattttagggataaatttgaaccctcacaaaatttttatccataaaatttgcactctctcaaatcac |
32345816 |
T |
|
| Q |
109 |
gatttgttgtggtcatcaaagtcacgcaatcatgcattgaagattgttcgatcaagatcagacaatcttgatttgagctcggtattttatgagttataca |
208 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32345815 |
gatttgttgtggtcatcaaaatcacacaatcatgcattgaagattgttcgatcaagatcagacagtcttgatttgagctcagtattttatgagttataca |
32345716 |
T |
|
| Q |
209 |
taaaattaaatttannnnnnnnagactgttcaatcaagatcagagg |
254 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
32345715 |
taaaattaattttatttttcctagactgttcaatcaagatcagagg |
32345670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 153 - 200
Target Start/End: Original strand, 24999653 - 24999700
Alignment:
| Q |
153 |
tgttcgatcaagatcagacaatcttgatttgagctcggtattttatga |
200 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| | |||||||||||| |
|
|
| T |
24999653 |
tgttcgatcaagatcagacgatcctgatttgagttaggtattttatga |
24999700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University