View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10800_low_3 (Length: 271)
Name: NF10800_low_3
Description: NF10800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10800_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 260
Target Start/End: Original strand, 50082300 - 50082545
Alignment:
| Q |
16 |
ataattgcgtcagtcacattctagaactaacaaaattgtattaatttcagtcatatttgttttggcttccttctacttttgtttgccgacctaattacta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082300 |
ataattgcgtcagtcacattctagaactaacaaagttgtattaatttcagtcatatttgttttggcttccttctacttttgtttgccgacctaattacta |
50082399 |
T |
 |
| Q |
116 |
gtctt--ggccatctttttattaatcttgataagtttggtagacaggtccaggctttcaacttcactttcaccatatctctaaaataatgtctcatttcc |
213 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082400 |
gtcttttggccatcttttt-ttaatcttgataagtttggtagacaggtccaggctttcaacttcactttcaccatatctctaaaataatgtctcatttcc |
50082498 |
T |
 |
| Q |
214 |
atacatataataatatatactattatttaacatacccacattttctt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082499 |
atacatataataatatatactattatttaacatacccacattttctt |
50082545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University