View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10801_low_11 (Length: 254)
Name: NF10801_low_11
Description: NF10801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10801_low_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 543412 - 543176
Alignment:
| Q |
18 |
aggggtagttattgcatatcataagtactcaatttgacggaaaagtaaacaaataacatcacgatcttaacagtaacaaatatttagacgacatctatat |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
543412 |
aggggtagttattccatatcataagtactcaaattgacggaaaagtaaacaaataacatcacgatcttaacagtaacaaatatttagacgacatctatat |
543313 |
T |
 |
| Q |
118 |
ctagatctataagccagttacataaatatatctgataggtttactccatgttctcgatcgaacccttatcttgggccttgttttttctttggttggtacg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
543312 |
ctagatctataagccagttacataaatatatctgataggtttactccatgttctcgatcgaacccttatcttgggccttgttttttctttggttggtacc |
543213 |
T |
 |
| Q |
218 |
ttttgcaccaaattgacttgccattgacaaagaagtt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
543212 |
ttttgcaccaaattgacttgccattgacaaagaagtt |
543176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University