View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10801_low_12 (Length: 252)
Name: NF10801_low_12
Description: NF10801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10801_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 40266152 - 40265971
Alignment:
| Q |
1 |
taatatattaatagattaatgtcaagcatctgtagtgggaccaaaagtcccaagtgggagcaaagtggggattggtggagaggagattagaggagattct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40266152 |
taatatatgaatagattaatgtcaagcatctgtagtgggacccaaagtcccacgtgggagcaaagtggggattggtggagaggagattagaggagattct |
40266053 |
T |
 |
| Q |
101 |
acttgaggagcaccaaacgcaattgtttgcttattacgtggcaatggagccattgttcacgtgacacgtggggcccttaatc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40266052 |
acttgaggagcaccaaacgcaattgtttgcttattacgtggcaatggagccattgttcacgtgacacgtggggcccttaatc |
40265971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 238
Target Start/End: Complemental strand, 40265955 - 40265919
Alignment:
| Q |
202 |
gtataatccatagtggcactagtagtaggtaaatttg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40265955 |
gtataatccatagtggcactagtagtaggtaaatttg |
40265919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University