View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10801_low_17 (Length: 214)
Name: NF10801_low_17
Description: NF10801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10801_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 197
Target Start/End: Complemental strand, 21601961 - 21601775
Alignment:
| Q |
11 |
tgagatgaacatgtatacttgatatatataaccttcttcaacgtgaaaataaaagttttgaggatgatgtttcttatttagtttattcaatcatcttctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21601961 |
tgagatgaacatgtatacttgatatatataaccttcttcaacgtgaaaataaaagttttgaggatgatgtttcttatttagtttattcaatcatcttctt |
21601862 |
T |
 |
| Q |
111 |
gatatgattgtttattcgataattagtaaaacacataaatatttataatcatgtaattcaattctgattatacatcacagcaacaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21601861 |
gatatgattgtttattcgataattagtaaaacacataaatatttataatcatgtaattcaattctgattatacatcacagcaacaat |
21601775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University