View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10802_low_10 (Length: 330)
Name: NF10802_low_10
Description: NF10802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10802_low_10 |
 |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0352 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 38 - 317
Target Start/End: Complemental strand, 16463 - 16185
Alignment:
| Q |
38 |
attattcaaagcagatctctaatccttcttgagaaggaaaaataatacacctgcaactgtagtcaattgaaaacaggtttctttaaattctttgctcacc |
137 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
16463 |
attattcaaagcagatctcaaatccttcttgagaaggaaaaacaatacacctgcaactgtagtcaattgaaaacaggttcctttaaattttttgctcacc |
16364 |
T |
 |
| Q |
138 |
ttttcagctttttcactctattatcacgccttcctaatatcaataattgatttacccnnnnnnnnnngaagaggcataatcgatttacccttattggtga |
237 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| || |
|
|
| T |
16363 |
ctttcatctttttcactctattctcacgccttcctaatatcaataattgatttaccc-tttttttttgaagaggcataatcgatttacacttattggcga |
16265 |
T |
 |
| Q |
238 |
tctattctcactgtagtcaattatttcgaagtttatgtttgttggaattttgttttcaatcgattaacatttgtggttct |
317 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16264 |
tctattctcaccgtagtcaattatttcgaagtttatgtttgttggaattttgttttcaatcgattaacatttgtggttct |
16185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University