View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10802_low_12 (Length: 296)
Name: NF10802_low_12
Description: NF10802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10802_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 285
Target Start/End: Original strand, 8660638 - 8660899
Alignment:
| Q |
20 |
acagatgctctatgacattgctagttggcaaatgagtattcccatgctgatccagaaaaatgtcataggagttcaaaaattaattatagtttttcacttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8660638 |
acagatgctctatgacattgctagttggcaaatgagtattcccatgctgatccagaaaaatgtcatagtagttcaaaaattaattatagtttttcacttc |
8660737 |
T |
|
| Q |
120 |
ttgtgtcttgtagtagtttgtttgatcatattgttgtttttatctctcatttcattgataatagggtagcattcattgtaaaagtttaccggcatgaata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8660738 |
ttgtgtcttgtagtagtttgtttgatcatattgttgtttttatctctcatttcattgataatagggtagcattcattgtaaaagtttaccggcatgaata |
8660837 |
T |
|
| Q |
220 |
acgattttggtcatctccccnnnnnnnaatgattatgggagattagaatgtaacacggcaaccttt |
285 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8660838 |
acgattttggtcatctcccctttttttaatgattatgggaga----aatgtaacacggcaaccttt |
8660899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University