View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10802_low_16 (Length: 250)
Name: NF10802_low_16
Description: NF10802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10802_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 38455091 - 38455245
Alignment:
| Q |
1 |
agggatcttggatcaaaaattgtaccaataattcgatattcatacccaaattgcccttggccttggcctatatgtttgacattcttttgctaacatccca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455091 |
agggatcttggatcacaaattgtaccaataattcgatattcatacccaaattgcccttggccttggcctatatgtttgacattcttttgctaacatccca |
38455190 |
T |
|
| Q |
101 |
acgtggagaatgaatgaatgaatgatagggtgcaacatcaatggtgcgtttgttccatc |
159 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455191 |
acgtgga----gaatgaatgaatgatagggtgcaacatcaatggtgcgtttgttccatc |
38455245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University